Bacteria Collection: Actinobacillus seminis

NCTC Number:	NCTC 10851
Current Name:	Actinobacillus seminis
Original Strain Reference:	K3844-C
Other Collection No:	ATCC 15768; K 3844-C
Previous Catalogue Name:	Actinobacillus seminus
Other Names:	ACTINOBACILLUS SALPINGITIDIS, (KOHLERT) MRAZ ET AL 1976
Type Strain:	Yes
Family:	Pasteurellaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Columbia blood agar, 24-48 hours, 37°C, aerobic
Conditions for growth on liquid media:	nutrient broth,37, facultative anaerobe
Isolated From:	mammal, sheep,semen
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1247842
16S rRNA Gene Sequence:	>gb|AF013276|NCTC 10851|Actinobacillus seminis 16S ribosomal RNA gene, partial sequence,tRNA-Ile and tRNA-Ala genes, complete sequence, and 23S ribosomalRNA gene, partial sequence.| gaagtcgtaacaagg... Close [x] gaagtcgtaacaaggtaaccgtaggggaacctgcggttggatcacctccttaactgaatgaagtgatagcgagtgttcac acagattggctgagatattgtagacaagaaaaagacgaagagacattcttttgggtctgtagctcaggtggttagagcgc acccctgataagggtgaggtcggtggttcaagtccactcagacccaccactcaatgctaatatagcatacttagagaaag tagaaagtaatataaattgagtgagagtgaaagctaaagggaagttgatgactggggatatagcttagctgggagagcgc ctgccttgcacgcaggaggtcagcggttccatcccgcttatctccaccaaatcatcatgcactaagtgcatagtgtaaac ccactttatgggtgatgaattttattaatatgtatttagtcatgatgatttgccgaaaggcaaatgtctattgttcttta aaaaataggaaacaagctgaaaactgagagatttttcaagtcagggcttaagaaagataagcgctgagagaaggaaagtc tgagtagttcgaaagaaagaaatcttaactgaagaaaggcggttaagtgtttagttgaaagatatcgccttaagcataaa atgcttgaggttgtatggttaagtgactaagcgtacacggtggatgccttg >gb|AF013275|NCTC 10851|Actinobacillus seminis 16S ribosomal RNA gene, partial sequence,tRNA-Glu gene, complete sequence, and 23S ribosomal RNA gene,partial sequence.| gaagtcgtaacaagg... Close [x] gaagtcgtaacaaggtaaccgtaggggaacctgcggttggatcacctccttaactgaatgaagtgatagcgagtgttcac acagattggctgagatattgtagacagaaaagaataagagaagagaccgcacttttagattgcttactaggtcgagtaat agaagtcgtattaataaagattaatatcaatatcaaggatgaaagtgcgaggaaagcaaagagattgtctttacctgatg tccccatcgtctagaggcctaggacatcgccctttcacggcggtaaccggggttcgaatccccgtggggacgccaattaa agatgattttaaattatcttattgttctttaaaaaataggaaacaagctgaaaactgagagatttttcaagtcagggctt aagaaagataagcgctgagagaaggaaagtctgagtagttcgaaagaaagaaatcttaactgaagaaaggcggttaagtg tttagttgaaagatatcgccttaagcataaaatgcttgaggttgtatggttaagtgactaagcgtacacggtggatgcct tg
23S rRNA Gene Sequence:	>gb|AF013276|NCTC 10851|Actinobacillus seminis 16S ribosomal RNA gene, partial sequence,tRNA-Ile and tRNA-Ala genes, complete sequence, and 23S ribosomalRNA gene, partial sequence.| gaagtcgtaacaagg... Close [x] gaagtcgtaacaaggtaaccgtaggggaacctgcggttggatcacctccttaactgaatgaagtgatagcgagtgttcac acagattggctgagatattgtagacaagaaaaagacgaagagacattcttttgggtctgtagctcaggtggttagagcgc acccctgataagggtgaggtcggtggttcaagtccactcagacccaccactcaatgctaatatagcatacttagagaaag tagaaagtaatataaattgagtgagagtgaaagctaaagggaagttgatgactggggatatagcttagctgggagagcgc ctgccttgcacgcaggaggtcagcggttccatcccgcttatctccaccaaatcatcatgcactaagtgcatagtgtaaac ccactttatgggtgatgaattttattaatatgtatttagtcatgatgatttgccgaaaggcaaatgtctattgttcttta aaaaataggaaacaagctgaaaactgagagatttttcaagtcagggcttaagaaagataagcgctgagagaaggaaagtc tgagtagttcgaaagaaagaaatcttaactgaagaaaggcggttaagtgtttagttgaaagatatcgccttaagcataaa atgcttgaggttgtatggttaagtgactaagcgtacacggtggatgccttg >gb|AF013275|NCTC 10851|Actinobacillus seminis 16S ribosomal RNA gene, partial sequence,tRNA-Glu gene, complete sequence, and 23S ribosomal RNA gene,partial sequence.| gaagtcgtaacaagg... Close [x] gaagtcgtaacaaggtaaccgtaggggaacctgcggttggatcacctccttaactgaatgaagtgatagcgagtgttcac acagattggctgagatattgtagacagaaaagaataagagaagagaccgcacttttagattgcttactaggtcgagtaat agaagtcgtattaataaagattaatatcaatatcaaggatgaaagtgcgaggaaagcaaagagattgtctttacctgatg tccccatcgtctagaggcctaggacatcgccctttcacggcggtaaccggggttcgaatccccgtggggacgccaattaa agatgattttaaattatcttattgttctttaaaaaataggaaacaagctgaaaactgagagatttttcaagtcagggctt aagaaagataagcgctgagagaaggaaagtctgagtagttcgaaagaaagaaatcttaactgaagaaaggcggttaagtg tttagttgaaagatatcgccttaagcataaaatgcttgaggttgtatggttaagtgactaagcgtacacggtggatgcct tg
Extended Bibliography:	Show bibliography Ref #: 16011 Author(s): Appuhamy,S.;Low,J.C.;Parton,R.;Coote,J.G. Journal: J Appl Microbiol Title: Specific PCR primers from the 16S-23S rRNA spacer region for the rapid detection and identification of Actinobacillus seminis Volume: 85 Page(s): 941-8 Year: 1999 Keyword(s): GENBANK/AF013275 GENBANK/AF013276 Actinobacillus/genetics/*isolation & purification Animals Base Sequence Cattle DNA Primers Male Molecular Sequence Data *Polymerase Chain Reaction/methods RNA, Bacterial/*analysis *RNA, Ribosomal, 16S *RNA, Ribosomal, 23S Semen/microbiology Sensitivity and Specificity Sheep Time Factors *rRNA Operon Remarks: Actinobacillus seminis is a common cause of ovine epididymitis and ram infertility. The ability to detect and identify this organism promptly is important commercially for the quality control of ram semen samples. Actinobacillus seminis is a fastidious and slow-growing bacterium and primary isolation and presumptive identification can be difficult and time-consuming. In this study, two ribosomal operons, termed rrnA and rrnB, have been characterized in the A. seminis genome, and these contain one and two tRNAs, respectively, in the spacer region between the 16S and 23S rRNA genes. Species-specific primers for A. seminis were developed from the sequence of the spacer region of rrnB for the identification and detection of A. seminis by PCR. The PCR assay was specific for A. seminis and gave no amplification products with phenotypically similar organisms such as Histophilus ovis. Storage solution used to preserve semen for long-term storage was found to inhibit the PCR. Therefore, for diagnostic purposes, the assay would best be performed after primary isolation or perhaps on fresh semen prior to storage if obvious contamination is indicated. URL: 9871313 Ref #: 12000 Author(s): Appuhamy,S.;Low,J.C.;Parton,R.;Coote,J.G. Journal: J Appl Microbiol Title: Specific PCR primers from the 16S-23S rRNA spacer region for the rapid detection and identification of Actinobacillus seminis Volume: 85 Page(s): 941-8 Year: 1999 Keyword(s): GENBANK/AF013275 GENBANK/AF013276 Actinobacillus/genetics/*isolation & purification Animal Base Sequence Cattle DNA Primers Male Molecular Sequence Data *Polymerase Chain Reaction/methods RNA, Bacterial/*analysis *RNA, Ribosomal, 16S *RNA, Ribosomal, 23S Semen/microbiology Sensitivity and Specificity Sheep Support, Non-U.S. Gov't Time Factors *rRNA Operon Remarks: Actinobacillus seminis is a common cause of ovine epididymitis and ram infertility. The ability to detect and identify this organism promptly is important commercially for the quality control of ram semen samples. Actinobacillus seminis is a fastidious and slow-growing bacterium and primary isolation and presumptive identification can be difficult and time-consuming. In this study, two ribosomal operons, termed rrnA and rrnB, have been characterized in the A. seminis genome, and these contain one and two tRNAs, respectively, in the spacer region between the 16S and 23S rRNA genes. Species-specific primers for A. seminis were developed from the sequence of the spacer region of rrnB for the identification and detection of A. seminis by PCR. The PCR assay was specific for A. seminis and gave no amplification products with phenotypically similar organisms such as Histophilus ovis. Storage solution used to preserve semen for long-term storage was found to inhibit the PCR. Therefore, for diagnostic purposes, the assay would best be performed after primary isolation or perhaps on fresh semen prior to storage if obvious contamination is indicated. URL: 99088479
Data:	(ATCC 15768) Type strain / ATCC in 1972 / G.C. Simmons / Sheep, semen / Baynes, I. D. & Simmons, G. C. (1960) Aust. Vet. J. 36, 454 / Sneath, P. H. A. & Stevens, M. (1990) Int. J. syst. Bact. 40, 148
Accession Date:	01/01/1972
History:	ATCC
Authority:	(ex Baynes and Simmons 1960) Sneath and Stevens 1990
Depositor:	SIMMONS G C
Taxonomy:	TaxLink: S3827 (Actinobacillus seminis (ex baynes and simmons 1960) sneath and stevens 1990) - Date of change: 16/06/2007 by NCTCUp to 16/06/2007: ? (NCTC 10851) - Date of change: 04/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.