skip to main content
UK Health Security Agency

Aag2-AF319

Aag2-AF319

Catalogue No.

19022602

Cell Line Name

Aag2-AF319

Cell Line Description

Aag2-AF319 is a clonal homozygous cell line containing a Dcr2 knockout mutation. It is derived from the Aag2-AF5 clonal derivative of the Aag2 cell line. A gRNA (TAGCAAAATTTAATCGTGCTAGG) targeting exon 1 of the Dcr2 gene was cloned into the Drosophila CRISPR vector pAc-sgRNA-Cas9 (Bassett et al. Biol. Open 3:42-49). This plasmid expresses gRNAs under control of the Drosophila U6 promoter and a human codon-optimized N-terminally FLAG-tagged Streptococcus pyogenes Cas9 enzyme linked to the puromycin resistance gene via a T2A polyprotein self-cleavage site under control of the Drosophila actin 5C promoter. Aag2-AF5 cells were transfected with the gRNA containing plasmid After 72 h, cells expressing the Cas9 construct were selected using puromycin and then sorted by flow cytometry into single-cell suspensions. Clones were expanded and screened for RNAi deficiency. The final clone selected was designated Aag2-AF319.

Characteristics

Products

These cells have a proven virus susceptibility for Zika virus and Semliki forest virus.

Tissue of Origin

Embryo

Morphology

Cell clusters and floating rounded cells

Applications

Propagation of viruses. Elucidation of molecular mechanisms of cellular response to viral infection.

Disease

No associated disease stated

Culture Conditions

Cell Type

Fibroblast-like

Subculture Routine

Subculture sub-confluent cultures (70-80%) as required (1-2 times a week) seeding cells between 2-5 x 10⁴ cells/cm². Remove culture medium and replace with fresh medium. Scrape monolayer of cells using cell scraper into the fresh media. Resuspend cells well by pipetting. Replace growth medium twice per week. Note: Cells may be slow to recover upon resuscitation and may have reduced viability. Cells may take up to 10 days to fully recover before subculturing. Cryopreservation medium: Complete growth medium containing 20% Foetal Bovine Serum and 10% (v/v) Dimethyl Sulphoxide (DMSO).

Culture Medium

L15 medium supplemented with 1% Non-Essential amino acids (NEAA), 1mM L-Glutamine, 10% Tryptose phosphate broth (TPB) and 10% Foetal Bovine Serum. Temperature: 28°C. Gassing: none.

Growth Mode

Adherent

Additional Info

Depositor

Kevin Maringer, University of Surrey, UK

Country of Origin

Israel

GMO Status

Genetically Modified Organism Class 1 (GMO1)

Genetic Modification

For full details see cell line description. Briefly; a gDNA targeting exon 1 was cloned into a Drosophila CRISPR vector which expresses gRNAs under control of the U6 promoter and a human codon- FLAG tagged Streptococcus pyogene Cas9 enzyme.

Hazard Group (ACDP)

Hazard Group (ACDP) 2

Applications

References

Varjak M, Maringer K, Watson M, Sreenu VB, Fredericks AC, Pondeville E, Donald CL, Sterk J, Kean J, Vazeille M, Failloux AB, Kohl A, Schnettler E. Aedes aegypti Piwi4 Is a Noncanonical PIWI Protein Involved in Antiviral Responses. mSphere. 2017 May 3;2(3). pii: e00144-17. doi: 10.1128/mSphere.00144-17. eCollection 2017 May-Jun.

Bibliography

Peleg J. Growth of arboviruses in primary tissue culture of Aedes aegypti embryos. Am. J. Trop. Med. Hyg. 17:219-223(1968). PubMed=4869110; DOI=10.4269/ajtmh.1968.17.219 Lan Q., Fallon A.M. Small heat shock proteins distinguish between two mosquito species and confirm identity of their cell lines.Am. J. Trop. Med. Hyg. 43:669-676(1990). PubMed=2267971; DOI=10.4269/ajtmh.1990.43.669 Barletta A.B.F., Silva M.C.L.N., Sorgine M.H.F. Validation of Aedes aegypti Aag- 2 cells as a model for insect immune studies. Parasites Vectors 5: 148 (2012). PubMed=22827926; DOI=10.1186/1756-3305-5-148

Available Formats

  • Frozen
  • DNA-5µg (100ng/µl)

If use of this culture results in a scientific publication, it should be cited in the publication as: Aag2-AF319 (ECACC 19022602).

Unless specified otherwise, at ECACC we routinely handle all of our cell lines at containment level 2 in accordance with the ACDP guidelines (Advisory Committee on Dangerous Pathogens) (UK). All cell cultures have the potential to carry as yet unidentified adventitious agents. It is the responsibility of the end user to ensure that their facilities comply with biosafety regulations for their own country. ACDP Guidance: Biological agents: Managing the risks in laboratories and healthcare premises.

The Culture Collections represent deposits of cultures from world-wide sources. While every effort is made to ensure details distributed by Culture Collections are accurate, Culture Collections cannot be held responsible for any inaccuracies in the data supplied. References where quoted are mainly attributed to the establishment of the cell culture and not for any specific property of the cell line, therefore further references should be obtained regarding cell culture characteristics. Passage numbers where given act only as a guide and Culture Collections does not guarantee the passage number stated will be the passage number received by the customer.

Cultures supplied by Culture Collections are for research purposes only. Enquiries regarding the commercial use of a cell line are referred to the depositor of the cell line. Some cell lines have additional special release conditions such as the requirement for a material transfer agreement to be completed by the potential recipient prior to the supply of the cell line. Please view the Terms & Conditions of Supply for more information.