Bacteria and Mycoplasmas detail

Conditions of Supply of Microbial Pathogens: Safety

Bacteria Collection: Lactobacillus acidophilus

NCTC Number:	NCTC 12980
Current Name:	Lactobacillus acidophilus
Other Collection No:	ATCC 4356; CIP 76.13; DSM 20079; WDCM 00098
Type Strain:	Yes
Family:	Lactobacillaceae
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	CBAR + blood concentration (10%) (Columbia Bartenella), 48-120 hours, 37°C, microaerophilic
16S rRNA Gene Sequence:	>gb\|AF429580\|ATCC 4356\|Lactobacillus acidophilus strain ATCC 4356 16S ribosomal RNA gene,partial sequence; 16S-23S intergenic spacer, complete sequence; and23S ribosomal RNA gene, partial sequence.\| agagtttgcaatgcc... Close [x] agagtttgcaatgcccaaagccggtggcctaaccttcggcaaggagccgactaaggcagggcagatgactggggtgaagt cctaacaaggtagccgtacgagaacctgcggctggatcacctcctttctaaggaagcgaaggatatggagagtagaaata ctaagagaagtatccagagcaagcggaagcacactgagaaactttgcttagttttgagggtaactcctcaagagagttac tacattgaaaactgaatataatccaatcaaaacaccgccacactaaaggagaacatactgtagagcgaccgataacagaa ttcttgaattaggtcaagtagaaaagggcgcacggtgaatgccttggcactgaaagccgatgaaggacgcgactaactac gaaagtcttcggggagccgtaagtaggctttgatccggaggtctccgaatggggaacccagcatgtgcagaatgctatcc ttaagtgaatacatagcttaaggagggaacacgcagcga
23S rRNA Gene Sequence:	>gb\|AF429580\|ATCC 4356\|Lactobacillus acidophilus strain ATCC 4356 16S ribosomal RNA gene,partial sequence; 16S-23S intergenic spacer, complete sequence; and23S ribosomal RNA gene, partial sequence.\| agagtttgcaatgcc... Close [x] agagtttgcaatgcccaaagccggtggcctaaccttcggcaaggagccgactaaggcagggcagatgactggggtgaagt cctaacaaggtagccgtacgagaacctgcggctggatcacctcctttctaaggaagcgaaggatatggagagtagaaata ctaagagaagtatccagagcaagcggaagcacactgagaaactttgcttagttttgagggtaactcctcaagagagttac tacattgaaaactgaatataatccaatcaaaacaccgccacactaaaggagaacatactgtagagcgaccgataacagaa ttcttgaattaggtcaagtagaaaagggcgcacggtgaatgccttggcactgaaagccgatgaaggacgcgactaactac gaaagtcttcggggagccgtaagtaggctttgatccggaggtctccgaatggggaacccagcatgtgcagaatgctatcc ttaagtgaatacatagcttaaggagggaacacgcagcga
Accession Date:	14/06/2007
Taxonomy:	TaxLink: S1539 (Lactobacillus acidophilus (moro 1900) hansen and mocquot 1970) - Date of change: 31/05/2007
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

Additional Information

Note: Links open in a new window

Product Documents

Note: Links open in a new window

Note:

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.