Bacteria Collection: Streptococcus equinus

NCTC Number:	NCTC 12969
Current Name:	Streptococcus equinus
Other Collection No:	ATCC 9812; CIP 102504; DSM 20558
Type Strain:	Yes
Family:	Streptococcaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Columbia blood agar, 24-48 hours, 37°C, aerobic
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS921427
16S rRNA Gene Sequence:	>gb|AY347547|ATCC 9812|Streptococcus equinus strain ATCC 9812 16S-23S ribosomal RNAintergenic spacer, complete sequence.| tcacctcctttctaa... Close [x] tcacctcctttctaaggataaacggaagcacgtttggagtattgtttagttttgagaggtcttgtggggccttagctcag ctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgctaggctccattgaatcgaaagattcaaagat tgtccattgaaaattgaatatctatatcaaattccacgattcaagaaattgaattgtagatagtaacaagaaataaaccg aaacgctgtgatttaatgagtttaaggtcaacagaccaaaataa
23S rRNA Gene Sequence:	>gb|AY347547|ATCC 9812|Streptococcus equinus strain ATCC 9812 16S-23S ribosomal RNAintergenic spacer, complete sequence.| tcacctcctttctaa... Close [x] tcacctcctttctaaggataaacggaagcacgtttggagtattgtttagttttgagaggtcttgtggggccttagctcag ctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgctaggctccattgaatcgaaagattcaaagat tgtccattgaaaattgaatatctatatcaaattccacgattcaagaaattgaattgtagatagtaacaagaaataaaccg aaacgctgtgatttaatgagtttaaggtcaacagaccaaaataa
Extended Bibliography:	Show bibliography Ref #: 13839 Author(s): Drancourt,M.;Roux,V.;Fournier,P.E.;Raoult,D. Journal: J Clin Microbiol Title: rpoB gene sequence-based identification of aerobic Gram-positive cocci of the genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella Volume: 42 Page(s): 497-504 Year: 2004 Keyword(s): Base Sequence DNA Primers DNA-Directed RNA Polymerases/chemistry/*genetics Enterococcus/enzymology/*genetics Lactobacillaceae/enzymology/*genetics Sequence Alignment Sequence Homology, Nucleic Acid Staphylococcaceae/enzymology/*genetics Streptococcaceae/enzymology/*genetics Streptococcus/enzymology/*genetics Remarks: We developed a new molecular tool based on rpoB gene (encoding the beta subunit of RNA polymerase) sequencing to identify streptococci. We first sequenced the complete rpoB gene for Streptococcus anginosus, S. equinus, and Abiotrophia defectiva. Sequences were aligned with these of S. pyogenes, S. agalactiae, and S. pneumoniae available in GenBank. Using an in-house analysis program (SVARAP), we identified a 740-bp variable region surrounded by conserved, 20-bp zones and, by using these conserved zones as PCR primer targets, we amplified and sequenced this variable region in an additional 30 Streptococcus, Enterococcus, Gemella, Granulicatella, and Abiotrophia species. This region exhibited 71.2 to 99.3% interspecies homology. We therefore applied our identification system by PCR amplification and sequencing to a collection of 102 streptococci and 60 bacterial isolates belonging to other genera. Amplicons were obtained in streptococci and Bacillus cereus, and sequencing allowed us to make a correct identification of streptococci. Molecular signatures were determined for the discrimination of closely related species within the S. pneumoniae-S. oralis-S. mitis group and the S. agalactiae-S. difficile group. These signatures allowed us to design a S. pneumoniae-specific PCR and sequencing primer pair. URL: 14766807 Ref #: 82554 Author(s): Chen,C.C.;Teng,L.J.;Chang,T.C. Journal: J Clin Microbiol Title: Identification of clinically relevant viridans group streptococci by sequence analysis of the 16S-23S ribosomal DNA spacer region Volume: 42 Page(s): 2651-7 Year: 2004 Keyword(s): DNA, Ribosomal Spacer/*chemistry Humans Phylogeny Polymerase Chain Reaction RNA, Ribosomal, 16S/*genetics RNA, Ribosomal, 23S/*genetics Sequence Analysis, DNA Viridans Streptococci/classification/genetics/*isolation & purification Remarks: The feasibility of sequence analysis of the 16S-23S ribosomal DNA (rDNA) intergenic spacer (ITS) for the identification of clinically relevant viridans group streptococci (VS) was evaluated. The ITS regions of 29 reference strains (11 species) of VS were amplified by PCR and sequenced. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The ITS lengths (246 to 391 bp) and sequences were highly conserved among strains within a species. The intraspecies similarity scores for the ITS sequences ranged from 0.98 to 1.0, except for the score for S. gordonii strains. The interspecies similarity scores for the ITS sequences varied from 0.31 to 0.93. Phylogenetic analysis of the ITS regions revealed that evolution of the regions of some species of VS is not parallel to that of the 16S rRNA genes. One hundred six clinical isolates of VS were identified by the Rapid ID 32 STREP system (bioMerieux Vitek, Marcy l'Etoile, France) and by ITS sequencing, and the level of disagreement between the two methods was 18% (19 isolates). Most isolates producing discrepant results could be unambiguously assigned to a specific species by their ITS sequences. The accuracy of using ITS sequencing for identification of VS was verified by 16S rDNA sequencing for all strains except strains of S. oralis and S. mitis, which were difficult to differentiate by their 16S rDNA sequences. In conclusion, identification of species of VS by ITS sequencing is reliable and could be used as an alternative accurate method for identification of VS. URL: 15184447
Accession Date:	14/06/2007
Taxonomy:	TaxLink: S2838 (Streptococcus equinus andrewes and horder 1906) - Date of change: 31/05/2007
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.