Bacteria Collection: Fusobacterium ulcerans

NCTC Number:	NCTC 12112
Current Name:	Fusobacterium ulcerans
Original Strain Reference:	Papua New Guinea
Previous Catalogue Name:	Fusobacterium ulcerans
Type Strain:	No
Family:	Fusobacteriaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Fastidious anaerobe agar, 48 hours, 37°C, anaerobic
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS630944
Annotated Genome:	ftp://ftp.sanger.ac.uk/pub/project/pathogens/NCTC3000/d...
16S rRNA Gene Sequence:	>gb|AF342852|NCTC 12112|Fusobacterium ulcerans strain NCTC 12112 16S ribosomal RNA gene,partial sequence; internal transcribed spacer 1, complete sequence;and 23S ribosomal RNA gene, partial sequence.| gaagtaacaggccta... Close [x] gaagtaacaggcctaaccgtaaggagggatgttccgagggtgtgattagcgattggggtgaagtcgtaacaaggtatccg tacgggaacgtgcggatggatcacctcctttctaaggagatcatttctctttctctattctattgataatgttcttacag cgtattaagcgctggataacttatcaaatggacattggaaactatatagtagattaaatacaattttaactcttgtttat ataaacagagttagctgtcaatcaaattaaacaaaaacaaaataggttaaaataattaagggcacacagggaatgcctag gtagtaagagccgatgaaggacgtggtaagctgcgataagcttgggttagctgcaaacgagcgccaaccccangatttcc gaatggagcaatctgctaagatggagtcttagcacgaaagagggtaccgagtgaactgaaacatctaagtaactcgagga aaagaaagtaaaaacgattccccaagtagcggcgagcgaacggggatgagcctaaaccatataagtgtcaaggatacagc cgttgcttatatggggttgtgggaagaacgtttgaagaactgtaagatattcaacatatctaatgaccgaactggaacta gttggaaagctagatcgtagaaggtgataatcctgtacaggtaaactcattagaatgtatgttctctcccaagtaacatg gaacacgaggaattctgtgtgaatctgcgaggaccatatctcgtaaggctaaatactct
23S rRNA Gene Sequence:	>gb|AF342852|NCTC 12112|Fusobacterium ulcerans strain NCTC 12112 16S ribosomal RNA gene,partial sequence; internal transcribed spacer 1, complete sequence;and 23S ribosomal RNA gene, partial sequence.| gaagtaacaggccta... Close [x] gaagtaacaggcctaaccgtaaggagggatgttccgagggtgtgattagcgattggggtgaagtcgtaacaaggtatccg tacgggaacgtgcggatggatcacctcctttctaaggagatcatttctctttctctattctattgataatgttcttacag cgtattaagcgctggataacttatcaaatggacattggaaactatatagtagattaaatacaattttaactcttgtttat ataaacagagttagctgtcaatcaaattaaacaaaaacaaaataggttaaaataattaagggcacacagggaatgcctag gtagtaagagccgatgaaggacgtggtaagctgcgataagcttgggttagctgcaaacgagcgccaaccccangatttcc gaatggagcaatctgctaagatggagtcttagcacgaaagagggtaccgagtgaactgaaacatctaagtaactcgagga aaagaaagtaaaaacgattccccaagtagcggcgagcgaacggggatgagcctaaaccatataagtgtcaaggatacagc cgttgcttatatggggttgtgggaagaacgtttgaagaactgtaagatattcaacatatctaatgaccgaactggaacta gttggaaagctagatcgtagaaggtgataatcctgtacaggtaaactcattagaatgtatgttctctcccaagtaacatg gaacacgaggaattctgtgtgaatctgcgaggaccatatctcgtaaggctaaatactct
Extended Bibliography:	Show bibliography Ref #: 46426 Author(s): Conrads,G.;Claros,M.C.;Citron,D.M.;Tyrrell,K.L.;Merriam,V.;Goldstein,E.J. Journal: Int J Syst Evol Microbiol Title: 16S-23S rDNA internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Fusobacterium Volume: 52 Page(s): 493-9 Year: 2002 Keyword(s): GENBANK/AF342829 GENBANK/AF342830 GENBANK/AF342831 GENBANK/AF342832 GENBANK/AF342833 GENBANK/AF342834 GENBANK/AF342835 GENBANK/AF342836 GENBANK/AF342837 GENBANK/AF342838 GENBANK/AF342839 GENBANK/AF342840 GENBANK/AF342841 GENBANK/AF342842 GENBANK/AF342843 GENBANK/AF342844 GENBANK/AF342845 GENBANK/AF342846 GENBANK/AF342847 GENBANK/AF342848 GENBANK/AF342849 GENBANK/AF342850 GENBANK/AF342851 GENBANK/AF342852 GENBANK/AF342853 GENBANK/AF342854 GENBANK/AF342855 GENBANK/AF342856 GENBANK/AF342857 GENBANK/AF342858 GENBANK/AF342859 GENBANK/AF342860 GENBANK/AF342861 Base Sequence DNA Primers DNA, Ribosomal Spacer/*genetics Fusobacterium/*classification/genetics Molecular Sequence Data Phylogeny RNA, Ribosomal, 16S/chemistry RNA, Ribosomal, 23S/chemistry Species Specificity Remarks: The 16S-23S rDNA internal transcribed spacer (ITS) regions of all currently defined Fusobacterium species and related taxa such as Leptotrichia buccalis, Sebaldella termitidis and Streptobacillus moniliformans, were analysed to examine inter- and intraspecies as well as subspecies relationships. For the ITS-amplification, a new eubacterial universal primer pair was designed and used. The majority of the Fusobacterium strains, along with L. buccalis showed one major, and two to three weaker, distinct bands (short and long versions) with lengths of 800-830 bp and 1000-1100 bp. Nevertheless, six other patterns were also found within the genus Fusobacterium, demonstrating its heterogeneity. The ITS region was sequenced and found to consist both of conserved motifs, which functioned as a framework for alignment, and of variable sites, which provided high phylogenetic resolution. Analyses of the ITS-DNA sequences and ITS relative length (short version) allowed species and subspecies differentiation in most cases. The results confirmed the strikingly distant relationship between Fusobacterium prausnitzii and the genus Fusobacterium. Fusobacterium nucleatum subspecies, along with Fusobacterium naviforme, Fusobacterium simiae and Fusobacterium periodonticum, formed a cluster with an inherently high potential for diversification. Other clusters were formed by Fusobacterium necrophorum subspecies with Fusobacterium gonidaformans and by Fusobacterium varium with Fusobacterium mortiferum and Fusobacterium ulcerans. Fusobacterium russii as well as Fusobacterium perfoetens formed separate branches. Fusobacterium necrophorum subspp. necrophorum and funduliforme on the one hand, and Fusobacterium varium and Fusobacterium mortiferum on the other, were found to be very similar, even at the high-resolution ITS level. URL: 11931161 Ref #: 12703 Author(s): Conrads,G.;Claros,M.C.;Citron,D.M.;Tyrrell,K.L.;Merriam,V.;Goldstein,E.J. Journal: Int J Syst Evol Microbiol Title: 16S-23S rDNA internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Fusobacterium Volume: 52 Page(s): 493-9 Year: 2002 Keyword(s): GENBANK/AF342829 GENBANK/AF342830 GENBANK/AF342831 GENBANK/AF342832 GENBANK/AF342833 GENBANK/AF342834 GENBANK/AF342835 GENBANK/AF342836 GENBANK/AF342837 GENBANK/AF342838 GENBANK/AF342839 GENBANK/AF342840 GENBANK/AF342841 GENBANK/AF342842 GENBANK/AF342843 GENBANK/AF342844 GENBANK/AF342845 GENBANK/AF342846 GENBANK/AF342847 GENBANK/AF342848 GENBANK/AF342849 GENBANK/AF342850 GENBANK/AF342851 GENBANK/AF342852 GENBANK/AF342853 GENBANK/AF342854 GENBANK/AF342855 GENBANK/AF342856 GENBANK/AF342857 GENBANK/AF342858 GENBANK/AF342859 GENBANK/AF342860 GENBANK/AF342861 Base Sequence DNA Primers DNA, Ribosomal Spacer/*genetics Fusobacterium/*classification/genetics Molecular Sequence Data Phylogeny RNA, Ribosomal, 16S/chemistry RNA, Ribosomal, 23S/chemistry Species Specificity Support, Non-U.S. Gov't Remarks: The 16S-23S rDNA internal transcribed spacer (ITS) regions of all currently defined Fusobacterium species and related taxa such as Leptotrichia buccalis, Sebaldella termitidis and Streptobacillus moniliformans, were analysed to examine inter- and intraspecies as well as subspecies relationships. For the ITS-amplification, a new eubacterial universal primer pair was designed and used. The majority of the Fusobacterium strains, along with L. buccalis showed one major, and two to three weaker, distinct bands (short and long versions) with lengths of 800-830 bp and 1000-1100 bp. Nevertheless, six other patterns were also found within the genus Fusobacterium, demonstrating its heterogeneity. The ITS region was sequenced and found to consist both of conserved motifs, which functioned as a framework for alignment, and of variable sites, which provided high phylogenetic resolution. Analyses of the ITS-DNA sequences and ITS relative length (short version) allowed species and subspecies differentiation in most cases. The results confirmed the strikingly distant relationship between Fusobacterium prausnitzii and the genus Fusobacterium. Fusobacterium nucleatum subspecies, along with Fusobacterium naviforme, Fusobacterium simiae and Fusobacterium periodonticum, formed a cluster with an inherently high potential for diversification. Other clusters were formed by Fusobacterium necrophorum subspecies with Fusobacterium gonidaformans and by Fusobacterium varium with Fusobacterium mortiferum and Fusobacterium ulcerans. Fusobacterium russii as well as Fusobacterium perfoetens formed separate branches. Fusobacterium necrophorum subspp. necrophorum and funduliforme on the one hand, and Fusobacterium varium and Fusobacterium mortiferum on the other, were found to be very similar, even at the high-resolution ITS level. URL: 21928123
Data:	B. Adriaans, LSH & TM in 1987 / Skin ulcer / Adriaans, B. & Draser, B. S. (1987) Epidem. Inf. 99, 361 / Adriaans, B. & Shah, H. (1988) Int. J. syst. Bact. 38, 447
Accession Date:	04/02/2003
Authority:	Adriaans and Shah 1988
Taxonomy:	TaxLink: S1343 (Fusobacterium ulcerans adriaans and shah 1988) - Date of change: 16/06/2007 by NCTCUp to 16/06/2007: ? (NCTC 12112) - Date of change: 04/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.