Bacteria Collection: Bifidobacterium dentium

NCTC Number:	NCTC 11816
Current Name:	Bifidobacterium dentium
Original Strain Reference:	B764
Other Collection No:	ATCC 27534; B764; DSM 20436
Previous Catalogue Name:	Bifidobacterium dentium
Type Strain:	Yes
Family:	Bifidobacteriaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Columbia blood agar, 48 hours, 37°C, anaerobic
Isolated From:	human, dental caries
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1247832
16S rRNA Gene Sequence:	>gb|U10434|ATCC 27534|Bifidobacterium dentium ATCC 27534 16S-23S rRNA intergenic spacer.| tcacctcctttctac... Close [x] tcacctcctttctacggatgagtatcaggacgcngttcgtgtccggtgtgtgccccatgtgcgcgtggaacggttccacg gcccgtgtggggatgctggtgtggaagagatcgttggcttggacgggcctgtcccgtccgggagtggtatgggtgtgctt ttgggttccaggaccgccaccccacagtcttggattgtggtgcggttcgatgcccatgcggggtggcactcgtccgttgg acgcgtggcggaacgtgtggcgcgtggcggtttgagaactggatagtggacgcgagcaagggaaacatggtgtttccctt tgcttatcgcgatttcgccaaactcttctttttgagtttggtttcgagatcgatcgttttgtgatcatttgaacagtgcg atgatttgtcgtctggcaatcttacctatcaggaaagccgcgggatggcacggccgttggctgtgtcgcncgcaagnatg tgtggatgccttgg
23S rRNA Gene Sequence:	>gb|U10434|ATCC 27534|Bifidobacterium dentium ATCC 27534 16S-23S rRNA intergenic spacer.| tcacctcctttctac... Close [x] tcacctcctttctacggatgagtatcaggacgcngttcgtgtccggtgtgtgccccatgtgcgcgtggaacggttccacg gcccgtgtggggatgctggtgtggaagagatcgttggcttggacgggcctgtcccgtccgggagtggtatgggtgtgctt ttgggttccaggaccgccaccccacagtcttggattgtggtgcggttcgatgcccatgcggggtggcactcgtccgttgg acgcgtggcggaacgtgtggcgcgtggcggtttgagaactggatagtggacgcgagcaagggaaacatggtgtttccctt tgcttatcgcgatttcgccaaactcttctttttgagtttggtttcgagatcgatcgttttgtgatcatttgaacagtgcg atgatttgtcgtctggcaatcttacctatcaggaaagccgcgggatggcacggccgttggctgtgtcgcncgcaagnatg tgtggatgccttgg
Bibliography:	SCARDOVI V & CROCIANI F 1974 INT J SYST BACT 24 6
Extended Bibliography:	Show bibliography Ref #: 95526 Author(s): Leblond-Bourget,N.;Philippe,H.;Mangin,I.;Decaris,B. Journal: Int J Syst Bacteriol Title: 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifidobacterium phylogeny Volume: 46 Page(s): 102-11 Year: 1996 Keyword(s): GENBANK/L36967 GENBANK/L36968 GENBANK/X70971 GENBANK/X70972 GENBANK/X70973 Base Sequence Bifidobacterium/*classification/genetics DNA, Bacterial DNA, Ribosomal/*genetics Molecular Sequence Data Phylogeny Polymerase Chain Reaction Polymorphism, Genetic RNA, Ribosomal, 16S/*genetics RNA, Ribosomal, 23S/*genetics Remarks: In the last few years many attempts have been made to differentiate more than 20 Bifidobacterium species. It has been recognized that identification of bifidobacterial species is problematic because of phenetic and genetic heterogeneities. In order to contribute to our understanding of Bifidobacterium taxonomy, we studied Bifidobacterium phylogeny by performing both 16S rRNA and 16S to 23S (16S-23S) internally transcribed spacer (ITS) sequence analyses. In this study, we determined 16S rRNA sequences of five Bifidobacterium strains representing four species, and compared them with the sequences available in the GenBank database, and used them to construct a distance tree and for a bootstrap analysis. Moreover, we determined the ITS sequences of 29 bifidobacterial strains representing 18 species and compared these sequences with each other. We constructed a phylogenetic tree based on these sequence data and compared this tree with the tree based on 16S rRNA sequence data. We found that the two trees were similar topologically, suggesting that the two types of molecules provided the same kind of phylogenetic information. However, while 16S rRNA sequences are a good tool to infer interspecific links, the 16S-23S rDNA spacer data allowed us to determine intraspecific relationships. Each of the strains was characterized by its own ITS sequence; hence, 16S-23S rRNA sequences are a good tool for strain identification. Moreover, a comparison of the ITS sequences allowed us to estimate that the maximum level of ITS divergence between strains belonging to the same species was 13%. Our data allowed us to confirm the validity of most of the Bifidobacterium species which we studied and to identify some classification errors. Finally, our results showed that Bifidobacterium strains have no tRNA genes in the 16S-23S spacer region. URL: 8573484 Ref #: 12251 Author(s): Leblond-Bourget,N.;Philippe,H.;Mangin,I.;Decaris,B. Journal: Int J Syst Bacteriol Title: 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifidobacterium phylogeny Volume: 46 Page(s): 102-11 Year: 1996 Keyword(s): GENBANK/L36967 GENBANK/L36968 GENBANK/X70971 GENBANK/X70972 GENBANK/X70973 Base Sequence Bifidobacterium/*classification/genetics DNA, Bacterial DNA, Ribosomal/*genetics Molecular Sequence Data Phylogeny Polymerase Chain Reaction Polymorphism (Genetics) RNA, Ribosomal, 16S/*genetics RNA, Ribosomal, 23S/*genetics Support, Non-U.S. Gov't Remarks: In the last few years many attempts have been made to differentiate more than 20 Bifidobacterium species. It has been recognized that identification of bifidobacterial species is problematic because of phenetic and genetic heterogeneities. In order to contribute to our understanding of Bifidobacterium taxonomy, we studied Bifidobacterium phylogeny by performing both 16S rRNA and 16S to 23S (16S-23S) internally transcribed spacer (ITS) sequence analyses. In this study, we determined 16S rRNA sequences of five Bifidobacterium strains representing four species, and compared them with the sequences available in the GenBank database, and used them to construct a distance tree and for a bootstrap analysis. Moreover, we determined the ITS sequences of 29 bifidobacterial strains representing 18 species and compared these sequences with each other. We constructed a phylogenetic tree based on these sequence data and compared this tree with the tree based on 16S rRNA sequence data. We found that the two trees were similar topologically, suggesting that the two types of molecules provided the same kind of phylogenetic information. However, while 16S rRNA sequences are a good tool to infer interspecific links, the 16S-23S rDNA spacer data allowed us to determine intraspecific relationships. Each of the strains was characterized by its own ITS sequence; hence, 16S-23S rRNA sequences are a good tool for strain identification. Moreover, a comparison of the ITS sequences allowed us to estimate that the maximum level of ITS divergence between strains belonging to the same species was 13%. Our data allowed us to confirm the validity of most of the Bifidobacterium species which we studied and to identify some classification errors. Finally, our results showed that Bifidobacterium strains have no tRNA genes in the 16S-23S spacer region. URL: 96138969
Data:	(DSM 20436, ATCC 27534) Type strain / DSM in 1985 / ATCC / V. Scardovi / Dental caries / Scardovi, V. & Crociani, F. (1974) Int. J. syst. Bact. 24, 6
Accession Date:	01/01/1985
History:	SCARDOVI V - ATCC - DSM
Authority:	Scardovi and Crociani 1974 (AL)
Depositor:	DSM
Taxonomy:	TaxLink: S553 (Bifidobacterium dentium Scardovi and Crociani 1974) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.