Bacteria Collection: Legionella gormanii

NCTC Number:	NCTC 11401
Current Name:	Legionella gormanii
Original Strain Reference:	LS-13
Other Collection No:	ATCC 33297; LS-13
Previous Catalogue Name:	Fluoribacter gormanii
Type Strain:	Yes
Family:	Legionellaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Buffered Charcoal Yeast Extract agar (BCYE), 48 hours, 37°C, requires carbon dioxide
Isolated From:	soil;wet soil from a creek bank
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1234136
23S rRNA Gene Sequence:	>gb|AY883063|ATCC 33297|Fluoribacter gormanii strain ATCC 33297 23S ribosomal RNA gene,partial sequence; 23S-5S ribosomal RNA intergenic spacer, completesequence; and 5S ribosomal RNA gene, partial sequence.| gaagcgcagtaatgc... Close [x] gaagcgcagtaatgcgtgaagctaacttgtactaattggctgattgtcttgaccatataatctgagttacttcagattga ctgattcaataccggtgtgttgggaaaccaactcmataagatgaagtacgaataaatgcgttaaaatgtgacccttttta tttacctaatgcatgattcgggtataatacacccaatcaatgcaaaacagttttcctggcgaccatagcggtttggaacc acctgattccatctcgaactcagaagtgaa
Bibliography:	MORRIS G K ET AL 1980 J CLIN MICROBIOL 12 718 721
Extended Bibliography:	Show bibliography Ref #: 54192 Author(s): Ko,K.S.;Lee,H.K.;Park,M.Y.;Lee,K.H.;Yun,Y.J.;Woo,S.Y.;Miyamoto,H.;Kook,Y.H. Journal: J Clin Microbiol Title: Application of RNA polymerase beta-subunit gene (rpoB) sequences for the molecular differentiation of Legionella species Volume: 40 Page(s): 2653-8 Year: 2002 Keyword(s): Bacterial Proteins/genetics Bacterial Typing Techniques Base Sequence DNA, Bacterial/genetics DNA-Directed RNA Polymerases/*genetics *Genes, Bacterial Humans Immunophilins/genetics Legionella/classification/*enzymology/*genetics/isolation & purification Membrane Proteins/genetics *Peptidylprolyl Isomerase Phylogeny RNA, Bacterial/genetics RNA, Ribosomal, 16S/genetics Serotyping Species Specificity Remarks: The nucleotide sequences of the partial rpoB gene were determined from 38 Legionella species, including 15 serogroups of Legionella pneumophila. These sequences were then used to infer the phylogenetic relationships among the Legionella species in order to establish a molecular differentiation method appropriate for them. The sequences (300 bp) and the phylogenetic tree of rpoB were compared to those from analyses using 16S rRNA gene and mip sequences. The trees inferred from these three gene sequences revealed significant differences. This sequence incongruence between the rpoB tree and the other trees might have originated from the high frequency of synonymous base substitutions and/or from horizontal gene transfer among the Legionella species. The nucleotide variation of rpoB enabled more evident differentiation among the Legionella species than was achievable by the 16S rRNA gene and even by mip in some cases. Two subspecies of L. pneumophila (L. pneumophila subsp. pneumophila and subsp. fraseri) were clearly distinguished by rpoB but not by 16S rRNA gene and mip analysis. One hundred and five strains isolated from patient tissues and environments in Korea and Japan could be identified by comparison of rpoB sequence similarity and phylogenetic trees. These results suggest that the partial sequences of rpoB determined in this study might be applicable to the molecular differentiation of Legionella species. URL: 12089300 Ref #: 95452 Author(s): Grattard,F.;Ginevra,C.;Riffard,S.;Ros,A.;Jarraud,S.;Etienne,J.;Pozzetto,B. Journal: Microbes Infect Title: Analysis of the genetic diversity of Legionella by sequencing the 23S-5S ribosomal intergenic spacer region: from phylogeny to direct identification of isolates at the species level from clinical specimens Volume: 8 Page(s): 73-83 Year: 2006 Keyword(s): DNA, Bacterial/genetics DNA, Ribosomal Spacer/*genetics Legionella/*classification/*genetics/isolation & purification Phenotype *Phylogeny RNA, Ribosomal, 23S/*genetics Species Specificity Variation (Genetics)/*genetics Remarks: This study focuses on the interest of the hypervariable 23S-5S ribosomal intergenic spacer region (ISR) of the genus Legionella to analyze the phylogenic diversity of Legionella at the species and subspecies levels and to identify isolates directly from clinical specimens. The method, using a real-time PCR assay with a single primer pair followed by sequencing, was able to identify correctly 49 reference strains of Legionella belonging to 37 different species, including those implicated in human infections, and to clearly differentiate the three subspecies of L. pneumophila. Based on sequence similarities, the 23S-5S ISR sequences were much more variable than the rpoB and mip sequences (P<0.0001 by the Wilcoxon signed rank test). The 23S-5S ISR method was able to cluster Legionella species in accordance with phenotypic traits, such as autofluorescence or fatty acid membrane composition. Using maximum parsimony methods, the rpoB and 23S-5S ISR data sets were shown to be incongruent (P<0.001). In contrast, the 23S-5S ISR and the mip data sets were found to be congruent (P=0.313), suggesting the interest of combining these two regions to demonstrate phylogenetic links between Legionella species. This molecular assay was shown able to both detect Legionella DNA directly in respiratory specimens from patients exhibiting a Legionella infection and provide accurate identification of the bacterium at the species level in the tested specimens. These properties open a wide range of applications to the 23S-5S ISR sequencing method, from taxonomic analyses to clinical and epidemiological investigations. URL: 16198139
Data:	(ATCC 33297) Type strain / R. E. Weaver, CDC Atlanta in 1981 / G. Gorman / Wet soil from creek bank / Morris, G. K. et al. (1980) J. clin. Microbiol. 12, 718-721
Accession Date:	01/01/1981
History:	WEAVER R E, CDC ATLANTA, GEORGIA-GORMAN G IN 1975
Authority:	(Morris et al. 1980) Brown et al. 1981
Depositor:	WEAVER R E
Taxonomy:	TaxLink: S1317 (Legionella gormanii) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.