Bacteria and Mycoplasmas detail

Conditions of Supply of Microbial Pathogens: Safety

Bacteria Collection: Sphingobacterium spiritivorum

NCTC Number:	NCTC 11386
Current Name:	Sphingobacterium spiritivorum
Original Strain Reference:	E7288, CL 562/80
Other Collection No:	ATCC 33861; CCUG 13224; CDC E7288; CIP 100542; DSM 11722; GIFU 3101; JCM 1277; LMG 8347; NBRC 14948
Previous Catalogue Name:	Flavobacterium spiritivorum
Type Strain:	Yes
Family:	Sphingobacteriaceae
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Nutrient agar, 24-48 hours, 30°C, aerobic
Conditions for growth on liquid media:	nutrient broth,30,
Isolated From:	human, intra-uterine
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1003585
Annotated Genome:	ftp://ftp.sanger.ac.uk/pub/project/pathogens/NCTC3000/...
16S rRNA Gene Sequence:	>gb\|EF090267\|NCTC 11386\| KC1803\|Sphingobacterium spiritivorum strain NCTC 11386 16S ribosomal RNAgene, partial sequence.\| gatgaacgctagcgg... Close [x] gatgaacgctagcggcaggcctaatacatgcaagtcgaacgagattatccagcttgctggatatgaaagtggcgcacggg tgcgtaacgcgtgagcaacctacctctgtcagggggatagcccggcgaaagtcggattaacaccgcatgacattattgat gtggcatcacattataatcaaatatttataggacagagatgggctcgcgtgacattagctagttggagaggtaacggctc accaaggcaacgatgtctaggggctctgagaggagaatcccccacactggtactgagacacggaccagactcctacggga ggcagcagtaaggaatattggtcaatggagggaactctgaaccagccatgccgcgtgcaggatgactgccctatgggttg taaactgcttttgtcggggaataaacctacgtttgtaaacgtagctgaatgtacccgaagaataaggatcggctaactcc gtgccagcagccgcggtaatacggaggatccaagcgttatccggatttattgggtttaaagggtgcgtaggcggttcttt aagtcagaggtgaaagacggcagcttaactgtcgcagtgcctttgatactgaagaacttgaattaggttgaggaatgcgg aatgagacaagtagcggtgaaatgcatagatatgtctcagaaccccgattgcgaaggcagcattccaagcctttattgac gctgatgcacgaaagcgtggggatcgaacaggattagataccctggtagtccacgccctaaacgatgataactcgatgtt ggcgatagacagtcagcgtcccagcgaaagcgttaagttatccacctggggagtacgcccgcaagggtgaaactcaaagg aattgacgggggcccgcacaagcggaggagcatgtggtttaattcgatgatacgcgaggaaccttacccgggcttgaaag ttagtgaatgatccagagacggatcagtccttcgggacacgaaactaggtgctgcatggctgtcgtcagctcgtgccgtg aggtgttgggttaagtcccgcaacgagcgcaacccctatgtttagttgccagcatgtcatgatggggactctaaacagac tgcctgcgcaagcagagaggaaggtggggacgacgtcaagtcatcatggcccttacgtccggggctacacacgtgctaca atggtcggtacagcgggcagctacacagtaatgtgatgccaatctctgaaagccgatcacagttcggattgaggtctgca actcgacctcatgaagttggattcgctagtaatcgcgtatcagcaatgacgcggtgaatacgttcccgggccttgtacac accgcccgtcaagccatgaaagttgggggtgcctaaagcatgtaaccgcaaggagcgtgttagggcaaaaccgataattg gggct
Bibliography:	HOLMES ET AL 1981 INT J SYST BACT 32 157 165
Data:	Type strain / CDC, Atlanta in 1980 / Intra-uterine / Holmes, B. et al. (1981)
Accession Date:	01/01/1980
History:	HOLMES ET AL, NCTC, COLINDALE
Authority:	(Holmes et al. 1982) Yabuuchi et al. 1983
Depositor:	HOLMES B
Taxonomy:	TaxLink: S2729 (Sphingobacterium spiritivorum (holmes et al. 1982) yabuuchi et al. 1983) - Date of change: 16/06/2007 by NCTCUp to 16/06/2007: ? (NCTC 11386) - Date of change: 04/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

Additional Information

Note: Links open in a new window

Product Documents

Note: Links open in a new window

Note:

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.