Bacteria Collection: Pseudomonas synxantha

NCTC Number:	NCTC 10696
Current Name:	Pseudomonas synxantha
Original Strain Reference:	NCIB 8178
Other Collection No:	ATCC 9890; CCEB 293; IFO 3913; NCIB 8178; NRRL B-780
Previous Catalogue Name:	Pseudomonas synxantha
Type Strain:	Yes
Family:	Pseudomonadaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Nutrient agar, 24 hours, 30°C, aerobic
Conditions for growth on liquid media:	nutrient broth,30, aerobic
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1110715
Miscellaneous Sequence Data:	>gb|AB039415|IFO 3913|Pseudomonas synxantha gyrB gene for DNA gyrase subunit B, partialcds, strain:IFO 3913.| ccggtggtttgcacg... Close [x] ccggtggtttgcacggtgtaggtgtgtcggtagtgaacgcgctgtccgaagagttgattctcaccgttcgccgcagcggc aagatctgggaacagacctatgtccacggtgtgccgcaggagccgatgaaaatcgttggcgacagtgaaaccacgggcac ccagatccacttcaagccatcggctgaaaccttcaagaacatccacttcagctgggacatcctggccaagcggattcgtg aactgtccttcctcaactccggtgtcggtatcgtcctcaaggatgaacgcagcggcaaggaagaactgttcaagtacgaa ggcggcctgcgtgcattcgttgaatacctgaacaccaacaagactgcggtcaaccaggtgttccacttcaacatccagcg t
Bibliography:	VERON M & CHATELAIN R 1960 ANNLS INST PASTEUR PARIS 99 253; PARK R W A
Extended Bibliography:	Show bibliography Ref #: 71030 Author(s): Yamamoto,S.;Kasai,H.;Arnold,D.L.;Jackson,R.W.;Vivian,A.;Harayama,S. Journal: Microbiology Title: Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the nucleotide sequences of gyrB and rpoD genes Volume: 146 ( Pt 10) Page(s): 2385-94 Year: 2000 Keyword(s): GENBANK/AB039381 GENBANK/AB039382 GENBANK/AB039383 GENBANK/AB039384 GENBANK/AB039385 GENBANK/AB039386 GENBANK/AB039387 GENBANK/AB039388 GENBANK/AB039389 GENBANK/AB039390 GENBANK/AB039391 GENBANK/AB039392 GENBANK/AB039393 GENBANK/D37297 GENBANK/D37926 GENBANK/D86005 GENBANK/D86006 GENBANK/D86007 GENBANK/D86008 GENBANK/D86009 GENBANK/D86010 GENBANK/D86011 GENBANK/D86012 GENBANK/D86013 GENBANK/D86014 GENBANK/D86015 GENBANK/D86016 GENBANK/D86017 GENBANK/D86018 GENBANK/D86019 etc. Base Sequence DNA Gyrase DNA Topoisomerases, Type II/*genetics DNA-Directed RNA Polymerases/*genetics *Genes, Bacterial Molecular Sequence Data *Phylogeny Polymerase Chain Reaction/methods Pseudomonas/classification/*genetics Sigma Factor/*genetics Remarks: Phylogenetic analysis of the genus Pseudomonas: was conducted by using the combined gyrB and rpoD nucleotide sequences of 31 validly described species of Pseudomonas: (a total of 125 strains). Pseudomonas: strains diverged into two major clusters designated intrageneric cluster I (IGC I) and intrageneric cluster II (IGC II). IGC I was further split into two subclusters, the 'P: aeruginosa complex', which included P: aeruginosa, P: alcaligenes, P: citronellolis, P: mendocina, P: oleovorans and P: pseudoalcaligenes, and the 'P: stutzeri complex', which included P: balearica and P: stutzeri. IGC II was further split into three subclusters that were designated the 'P: putida complex', the 'P: syringae complex' and the 'P: fluorescens complex'. The 'P: putida complex' included P: putida and P: fulva. The 'P: syringae complex' was the cluster of phytopathogens including P: amygdali, P: caricapapayae, P: cichorii, P: ficuserectae, P: viridiflava and the pathovars of P. savastanoi and P. syringae. The 'P. fluorescens complex' was further divided into two subpopulations, the 'P. fluorescens lineage' and the 'P. chlororaphis lineage'. The 'P. fluorescens lineage' contained P. fluorescens biotypes A, B and C, P. azotoformans, P. marginalis pathovars, P. mucidolens, P. synxantha and P. tolaasii, while the 'P. chlororaphis lineage' included P. chlororaphis, P. agarici, P. asplenii, P. corrugata, P. fluorescens biotypes B and G and P. putida biovar B. The strains of P. fluorescens biotypes formed a polyphyletic group within the 'P. fluorescens complex'. URL: 11021915
Data:	(ATCC 9890, IFO 3913, NRRL B-780, CCEB 293) Type strain / NCIB in 1969 / ATCC in 1950 / R. S. Breed, New York / B. W. Hammer / V‚ron, M. & Chatelain, R. (1960) Annls. Inst. Pasteur, Paris 99, 253 / Hobbs, G. et al. (1961) J. appl. Bact. 24, 117 / Lysenko, O. (1961) J. gen. Microbiol. 25, 379 / Park, R. W. A. (1962) J. gen. Microbiol. 27, 121
Accession Date:	01/01/1969
History:	ISOLATED BY HAMMER B W -BREED R S NEW YORK - ATCC 1950
Authority:	(Ehrenberg 1840) Holland 1920 (AL)
Depositor:	NCIB
Taxonomy:	TaxLink: S2496 (Pseudomonas synxantha (Ehrenberg 1840) Holland 1920) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.