Bacteria and Mycoplasmas detail

Conditions of Supply of Microbial Pathogens: Safety

Bacteria Collection: Moraxella (branhamella) cuniculi

NCTC Number:	NCTC 10297
Current Name:	Moraxella (branhamella) cuniculi
Original Strain Reference:	K 19
Other Collection No:	ATCC 14688; K 19
Previous Catalogue Name:	Neisseria cuniculi
Type Strain:	Yes
Family:	Moraxellaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Chocolate blood agar, 24-48 hours, 37°C, requires carbon dioxide
Conditions for growth on liquid media:	nutrient broth,37, aerobic
Isolated From:	mammal, rabbit oral mucosa
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1211135
16S rRNA Gene Sequence:	>gb\|X79221\|NCTC 10297\|M.cuniculi (NCTC 10297) 16S rRNA gene.\| aggcttaacacatgc... Close [x] aggcttaacacatgcaagtcgaacgaagttagggagcttgctcctgatacttagtggcggacgggtgagtaatgcttagg aatctgcctagtagtgggggataactatccgaaaggatagctaataccgcatacgacctacgggtgaaagggggcgtaag ctctcgctattagatgagcctaagtcggattagctagttggtggggtaaaggcctaccaaggcgacgatctgtagctggt ctgagaggatgatcagccacactgggactgagacacggcccagactcctacgggaggcagcagtggggaatattggacaa tgggcgaaagcctgatccagccatgcccgcgtgtgtgaagaaggccttttggttgtaaagcactttaagtggggaggaaa agctaatagctaatacctattagccctgacgttacccacagaataagcaccggctaactctgtgccagcagccgcggtaa tacagagggtgcaagcgttaatcggaattactgggcgtaaagcgcgcgtaggtggttacttaagtcagatgtgaaagccc cgggcttaacctgggaactgcatctgatactgggtaactagagtaggtgagagggaagtagaattccaggtgtagcggtg aaatgcgtagagatctggaggaataccgatggcgaaggcagcttcctggcatcatactgacactgaggtgcgaaagcgtg ggtagcaa
Bibliography:	BERGER U 1962 Z HYG INFEKTKRANKH 148 445
Data:	(ATCC 14688) Type strain / U. Berger, Hamburg in 1962 / Rabbit, oral mucosa / Berger, U. (1962) Z. Hyg. InfektKrankh. 148, 445
Accession Date:	01/01/1962
Authority:	(Berger 1962) Boevre and Hagen 1984
Depositor:	BWERGER U
Taxonomy:	TaxLink: S1924 (Neisseria cuniculi) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

Additional Information

Note: Links open in a new window

Product Documents

Note: Links open in a new window

Note:

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.