Bacteria Collection: Mycoplasma fermentans

NCTC Number:	NCTC 10117
Current Name:	Mycoplasma fermentans
Original Strain Reference:	PG 18
Other Collection No:	ATCC 19989; PG 18
Previous Catalogue Name:	Mycoplasma fermentans
Type Strain:	Yes
Family:	Mycoplasmataceae
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1324144
16S rRNA Gene Sequence:	>gb|AF294992|ATCC 19989|Mycoplasma fermentans 16S-23S ribosomal RNA intergenic spacer,complete sequence; and 23S ribosomal RNA gene, partial sequence.| ctttctacggagtac... Close [x] ctttctacggagtacaaaagagtactttttaaagtactattaaccttatttcactagacctattttatttatatattttt tgttatgtggcttttttatgggtctaaagctttatatctagttttgagagaacaatatttttttctctcatttgttcttt gaaaactgaatagtaaattttttgatatttacaacgacatcaaaattaaattaaatggttaatttgttttgatttcatcg agaaaatcatattaattatgattcattgaaatgtcttaaaatacacatcataacaaactataacaataggaaaatacttt taaataaggaagagtttgtggtggatgccttgggtctgaaagtcgatgaaggacgtgattacctgcgataagcctcgtgg agccggaaatatgctatgaaacggggatttccgaatggggaaacctaactagggtaatgcctagttgccttgttctgaat tcataggaacttgagtgagacaccttgtgaactgaaacatcttagtagcaagaggaagagaaaataaacaatgatttctt tagtagcggcgagcgaacgagaaagagcccaaacccagcaatgggggttgtaggacgatctacatgaagttacaaaactt aatgatagcagaagcttttgggaagaagcggcatagagggtgatacccccgtatgtgaaattgttaagtcttctgatcgt atcctgagtagggcggggcacgtggaaccctgtctgaatctgccgggaccacccggtaaggctaaatactaatcagacac cgatagtgaactagtaccgtgagggaaaggtgaaaagaacccagagatgg
23S rRNA Gene Sequence:	>gb|AF294992|ATCC 19989|Mycoplasma fermentans 16S-23S ribosomal RNA intergenic spacer,complete sequence; and 23S ribosomal RNA gene, partial sequence.| ctttctacggagtac... Close [x] ctttctacggagtacaaaagagtactttttaaagtactattaaccttatttcactagacctattttatttatatattttt tgttatgtggcttttttatgggtctaaagctttatatctagttttgagagaacaatatttttttctctcatttgttcttt gaaaactgaatagtaaattttttgatatttacaacgacatcaaaattaaattaaatggttaatttgttttgatttcatcg agaaaatcatattaattatgattcattgaaatgtcttaaaatacacatcataacaaactataacaataggaaaatacttt taaataaggaagagtttgtggtggatgccttgggtctgaaagtcgatgaaggacgtgattacctgcgataagcctcgtgg agccggaaatatgctatgaaacggggatttccgaatggggaaacctaactagggtaatgcctagttgccttgttctgaat tcataggaacttgagtgagacaccttgtgaactgaaacatcttagtagcaagaggaagagaaaataaacaatgatttctt tagtagcggcgagcgaacgagaaagagcccaaacccagcaatgggggttgtaggacgatctacatgaagttacaaaactt aatgatagcagaagcttttgggaagaagcggcatagagggtgatacccccgtatgtgaaattgttaagtcttctgatcgt atcctgagtagggcggggcacgtggaaccctgtctgaatctgccgggaccacccggtaaggctaaatactaatcagacac cgatagtgaactagtaccgtgagggaaaggtgaaaagaacccagagatgg
Bibliography:	EDWARD D G FF & FREUNDT E A 1956 J GEN MICROBIOL 14 197
Extended Bibliography:	Show bibliography Ref #: 14410 Author(s): Kong,F.;James,G.;Gordon,S.;Zelynski,A.;Gilbert,G.L. Journal: Appl Environ Microbiol Title: Species-specific PCR for identification of common contaminant mollicutes in cell culture Volume: 67 Page(s): 3195-200 Year: 2001 Keyword(s): GENBANK/AF294989 GENBANK/AF294990 GENBANK/AF294991 GENBANK/AF294992 GENBANK/AF294993 GENBANK/AF294994 GENBANK/AF294995 GENBANK/AF294996 Cell Line/*microbiology DNA Primers DNA, Ribosomal Spacer/genetics Humans Molecular Sequence Data Mollicutes/*classification/genetics/*isolation & purification Polymerase Chain Reaction/*methods RNA, Ribosomal, 16S/genetics RNA, Ribosomal, 23S/genetics Sensitivity and Specificity Sequence Analysis, DNA Species Specificity Remarks: Mycoplasma arginini, M. fermentans, M. hyorhinis, M. orale, and Acholeplasma laidlawii are the members of the class Mollicutes most commonly found in contaminated cell cultures. Previous studies have shown that the published PCR primer pairs designed to detect mollicutes in cell cultures are not entirely specific. The 16S rRNA gene, the 16S-23S rRNA intergenic spacer region, and the 5' end of the 23S rRNA gene, as a whole, are promising targets for design of mollicute species-specific primer pairs. We analyzed the 16S rRNA genes, the 16S-23S rRNA intergenic spacer regions, and the 5' end of the 23S rRNA genes of these mollicutes and developed PCR methods for species identification based on these regions. Using high melting temperatures, we developed a rapid-cycle PCR for detection and identification of contaminant mollicutes. Previously published, putative mollicute-specific primers amplified DNA from 73 contaminated cell lines, but the presence of mollicutes was confirmed by species-specific PCR in only 60. Sequences of the remaining 13 amplicons were identified as those of gram-positive bacterial species. Species-specific PCR primers are needed to confirm the presence of mollicutes in specimens and for identification, if required. URL: 11425741 Ref #: 95481 Author(s): Kim,K.S.;Ko,K.S.;Chang,M.W.;Hahn,T.W.;Hong,S.K.;Kook,Y.H. Journal: FEMS Microbiol Lett Title: Use of rpoB sequences for phylogenetic study of Mycoplasma species Volume: 226 Page(s): 299-305 Year: 2003 Keyword(s): GENBANK/AY191418 GENBANK/AY191419 GENBANK/AY191420 GENBANK/AY191421 GENBANK/AY191422 GENBANK/AY191423 GENBANK/AY191424 GENBANK/AY191425 GENBANK/AY191426 GENBANK/AY191427 GENBANK/AY191428 GENBANK/AY191429 GENBANK/AY191430 GENBANK/AY191431 GENBANK/AY191432 GENBANK/AY191433 GENBANK/AY191434 GENBANK/AY191435 GENBANK/AY191436 GENBANK/AY191437 GENBANK/AY191438 GENBANK/AY191439 GENBANK/AY191440 GENBANK/AY191441 GENBANK/AY191442 GENBANK/AY191443 Amino Acid Sequence DNA, Ribosomal/chemistry/genetics DNA-Directed RNA Polymerases/*chemistry/*genetics Genes, Bacterial Molecular Sequence Data Mycoplasma/classification/*genetics *Phylogeny RNA, Ribosomal, 16S/genetics Sequence Alignment Sequence Homology, Amino Acid Sequence Homology, Nucleic Acid Ureaplasma/genetics Remarks: rpoB sequences encoding the beta-subunit of RNA polymerase were determined in 26 Mycoplasma species for phylogenetic study. The portion of rpoB DNA used in this study showed a high degree of variation in terms of size and sequence among species. The rpoB phylogenies inferred from amino acid and nucleotide sequences were used to divide the mycoplasmas into two groups, a 'pneumoniae group' and a 'hominis group', which was consistent with the result from 16S rDNA sequence analysis. However, phylogenetic relationships within these groups differed in the two gene trees, which were supported by the incongruence length difference (ILD) test. This indicates that multiple gene sequences must be applied to infer accurate phylogenetic relationships among the mycoplasmas. The rpoB sequence, and especially the deduced amino acid sequence, offers a good alternative marker. URL: 14553926 Ref #: 11947 Author(s): Kong,F.;James,G.;Gordon,S.;Zelynski,A.;Gilbert,G.L. Journal: Appl Environ Microbiol Title: Species-specific PCR for identification of common contaminant mollicutes in cell culture Volume: 67 Page(s): 3195-200 Year: 2001 Keyword(s): GENBANK/AF294989 GENBANK/AF294990 GENBANK/AF294991 GENBANK/AF294992 GENBANK/AF294993 GENBANK/AF294994 GENBANK/AF294995 GENBANK/AF294996 Cell Line/*microbiology DNA Primers DNA, Ribosomal Spacer/genetics Human Molecular Sequence Data Mollicutes/*classification/genetics/*isolation & purification Polymerase Chain Reaction/*methods RNA, Ribosomal, 16S/genetics RNA, Ribosomal, 23S/genetics Sensitivity and Specificity Sequence Analysis, DNA Species Specificity Remarks: Mycoplasma arginini, M. fermentans, M. hyorhinis, M. orale, and Acholeplasma laidlawii are the members of the class Mollicutes most commonly found in contaminated cell cultures. Previous studies have shown that the published PCR primer pairs designed to detect mollicutes in cell cultures are not entirely specific. The 16S rRNA gene, the 16S-23S rRNA intergenic spacer region, and the 5' end of the 23S rRNA gene, as a whole, are promising targets for design of mollicute species-specific primer pairs. We analyzed the 16S rRNA genes, the 16S-23S rRNA intergenic spacer regions, and the 5' end of the 23S rRNA genes of these mollicutes and developed PCR methods for species identification based on these regions. Using high melting temperatures, we developed a rapid-cycle PCR for detection and identification of contaminant mollicutes. Previously published, putative mollicute-specific primers amplified DNA from 73 contaminated cell lines, but the presence of mollicutes was confirmed by species-specific PCR in only 60. Sequences of the remaining 13 amplicons were identified as those of gram-positive bacterial species. Species-specific PCR primers are needed to confirm the presence of mollicutes in specimens and for identification, if required. URL: 21318714
Data:	(ATCC 19989) Type strain / MRL Colindale in 1967 / D. G. ff. Edward Beckenham / M. Rutter and H. M. M. Wenholt / Edward, D. G. ff. & Freundt, E. A. (1956) J. gen. Microbiol. 14, 197
Accession Date:	01/01/1967
History:	ISOLATED BY RUTTER & WENHOLT HMM-EDWARD D G FF BECKENHAM RESTR:WHO CLASS 2
Authority:	Edward 1955 (AL)
Depositor:	MYCOPLASMA REF LAB COLINDALE
Taxonomy:	TaxLink: S2032 (Mycoplasma fermentans Edward 1955) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.